Primary Identifier | MGI:7378264 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Gpr151 |
Strain of Origin | C57BL/6J | Is Recombinase | false |
Is Wild Type | false |
molecularNote | CRISPR/Cas9 technology using two sgRNAs targeting sites just upstream of the translation start codon in exon 1 (ATCAAGCTCCTCCCTGCAGA) and within the 3â untranslated region (TCATCAATATTGCTAAGCAG) generated a 1343 bp deletion. |