| Primary Identifier | MGI:7432284 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Diras2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAGTGCGTGGTCATGTGAG and CGGAACAGAGCAACGACTAC, which resulted in a 576 bp deletion beginning at Chromosome 13 position 52,507,673 bp and ending after 52,508,248 bp (GRCm38/mm10). This mutation deletes 576 bp from ENSMUSE00000409549 (exon 2) and is predicted to cause an early termination after amino acid residue 7. |
