| Primary Identifier | MGI:5755139 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hsd17b8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project H2-Ke6-7445J-M8453 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTAACACCAAAGACCACAA, CACCAAAGACCACAAAGGGC, CCCTTCTTCTCCCGCTTCCG, and GGCTCTCGCTGACATGGCCC, which resulted in a 415 bp deletion spanning ENSMUSE00000300481 (exon 2) beginning at Chromosome 17 negative strand position 34,027,961 bp, CCATGTCAGCGAGAGCCACC and ending after GGCCCTTTGTGGTCTTTGGTG at 34,027,547 bp (GRCm38/mm10). This mutation deletes exon 2 and 197 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 14 and early truncation 18 amino acids later. |
