| Primary Identifier | MGI:6275185 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arl5a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTAACGTTGAGTCTCTGTA and TGGCCGTGTAGAATGAGAAG, which resulted in a 1020 bp deletion beginning at Chromosome 2 position 52,415,850 bp and ending after 52,416,869 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000264020 and ENSMUSE00000264010 (exons 2 and 3) and 811 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 17 amino acids later. |
