| Primary Identifier | MGI:7466148 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pomp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Baylor College of Medicine by injecting CAS9 RNA and 4 guide sequences AATCCGGGTTATCTGACACCAGG, TGTCAGATAACCCGGATTTGGGG, TGTCAGATAACCCGGATTTGTGG, ACAAGGGTCATGTGCTACAGAGG, which resulted in a Exon Deletion. Germline transmission of the exon deletion allele from a founder animal failed. |
