| Primary Identifier | MGI:5763778 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Crebzf |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Crebzf-7607J-M4528 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAGCGCTGCATCTCGG, GGTGCCAGTCCGGTTGCCGA, GCCGCGTCGTCCTCTTCCCG and GGTGTCGGTGGAGTTCTGCT, which resulted in a 679 bp deletion in exon 1 beginning at Chromosome 7 positive strand position 90443370 bp, CTCGGCAACCGGACTGGCAC, and ending after AAGGTGTCGGTGGAGTTCTG at 90444048 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 120 and early truncation 15 amino acids later. |
