Primary Identifier | MGI:5807486 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Actg2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Actg2-8089J-M2448 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGATTGTGAAGAAAAACC, CAGGATTGTGAAGAAAAACC, ACCCCATATCCACTTCCCAT and ACAGATCTGCTGTGGTTGGG, which resulted in a 484 bp deletion beginning at Chromosome 6 negative strand position 83,523,034 bp CATGGGAAGTGGATATGGGG, and ending after GAGTTCCCAACAGAGAGTCC at 83,522,551 bp (GRCm38/mm10). This mutation deletes exon 5 and 399 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp deletion 40 bp before the start of the 484 bp deletion that will not alter the result of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 40 amino acids later. |