| Primary Identifier | MGI:6317369 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Znhit1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGCCCTCTGTGTCATGGGA and TGGGGCAAAGAGAGTTACCG, which resulted in a 2990 bp deletion beginning at Chromosome 5 position 136,982,083 bp and ending after 136,985,072 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000498794 through ENSMUSE00000686647 (exons 2 through 5) and 2315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 2 amino acids later. |
