| Primary Identifier | MGI:7311988 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ctu1 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GGAGATGGCGTCCTACTGAG and GCAGTCACCCTATTATAGAT, which resulted in a 3606 bp deletion beginning at Chromosome 7 position 43,674,889 bp and ending after 43,678,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000279483, ENSMUSE00000401936 (exons 2 and 3) and 1191 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele. |
