| Primary Identifier | MGI:6362049 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Bcl7c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGATCTAAGAAGCCGG and ACTCTGGCAATGAAGACCCG, which resulted in a 1218 bp deletion beginning at Chromosome 7 position 127,707,019 bp and ending after 127,708,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264459 through ENSMUSE00000203727 (exons 2-4) and 868 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation. There is a 26 bp insertion (GGGCCAAGCTTGCTAGAGTGTCAAAA) at the deletion site. |
