Primary Identifier | MGI:6313402 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tmem147 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTCCCCATGAGAACCTGG and AAAAGTCTAGAAGTTCACGG, which resulted in a 1369 bp deletion beginning at Chromosome 7 position 30,727,564 bp and ending after 30,728,932 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200571-ENSMUSE00001376528 (exons 3-7) and 766 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 9 amino acids later. |