Primary Identifier | MGI:5638888 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Dnase1l2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Dnase1l2-6639J-M2859 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ex3.g1-GGCCGGCTATGATATCGCCC, int2.g1- GGCAATTAGGCTGATTGGGA, and int3.g1- TTGGTTCGGTGCCTTGACCC, which resulted in a 198bp deletion beginning in intron 2 at CTGATTGGGACGGTGCATCTGTGGG Chromosome 17 negative strand position 24,442,529 bp (GRCm38) and ending after GGTGCCTTGACCCAGGGACTGG at position 24,442,332 bp in intron 3. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 48 and early truncation 16 amino acids later. |