| Primary Identifier | MGI:6403854 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pop5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTTCGACAGTTTTGTGG and GCGTTTTGTACGATAGTGGA, which resulted in a 611 bp deletion beginning at Chromosome 5 position 115,237,751 bp and ending after 115,238,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519136, ENSMUSE00000465080 (exons 2 and 3) and 222 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |
