|  Help  |  About  |  Contact Us

Allele : Etv6<em1(IMPC)Rbrc> ets variant 6; endonuclease-mediated mutation 1, RIKEN BioResource Center

Primary Identifier  MGI:6257614 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Etv6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJcl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 Protein and the guide sequence CCCATTGAGAGCAACAAGTTCGA, which resulted in a Indel.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele