| Primary Identifier | MGI:7565599 | Allele Type | Endonuclease-mediated |
| Gene | Ager | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codons 214 (CGG), 215 (CGC) and 216 (AGA) in exon 6 were changed to alanine (GCA), histidine (CAT) and alanine (GCT) (p.R214_R216delinsAHA), respectively, using an sgRNA (targeting GGGGCCGCGTCTGGGGACTTGTG) and an ssODN template with CRISPR/Cas9 technology. The mutations in the C1 domain of the encoded peptide render it heparan sulfate (HS)-binding deficient which blocks oligomerization. |
