| Primary Identifier | MGI:6385151 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lilrb4b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCTGTGATTATCTGGTGT and TTTATGACAGCCTCATATGC, which resulted in a 137 bp deletion beginning at Chromosome 10 position 51,481,213 bp and ending after 51,481,349 bp (GRCm38/mm10). This mutation deletes 137 bp from ENSMUSE00001008219 (exon 3) and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later. |
