Primary Identifier | MGI:6404191 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tifab |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCCTTGGGTCTGTAAATC and GAGCCTGTACCACCCTACAC, which resulted in a 368 bp deletion beginning at Chromosome 13 position 56,176,215 bp and ending after 56,176,582 bp (GRCm38/mm10). This mutation deletes 368 bp from ENSMUSE00001037023 (exon 3) and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 17 amino acids later. There is a 4 bp insertion (GGCT) at the deletion site. |