|  Help  |  About  |  Contact Us

Allele : Lmcd1<em1(IMPC)J> LIM and cysteine-rich domains 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5771567 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lmcd1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Lmcd1-7683J-M3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATGCCAAGTCTCCCAG, GCTGCCACTCACTGTTTACT, GACGGTGTAGGATGCATGCT and GAGAGAACCACCCACAGTTT, which resulted in a 276 bp deletion spanning exon 2 beginning at Chromosome 6 positive strand position 112,304,920 bp, CAGTAAACAGTGAGTGGCAG, and ending after CTTGACTGTCCTTTCCAAAA at 112,305,195 bp (GRCm38/mm10). This mutation deletes exon 2 and 187 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a small 12 bp deletion 33 bp after the 276 bp deletion which will not affect the mutation. The 276 bp deletion is predicted to cause a change of amino acid sequence after residue 14 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Lmcd1<em1J>,
  • Lmcd1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories