| Primary Identifier | MGI:7543636 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tmx3 |
| Strain of Origin | C57BL/6-Mib1<em2Jlp> | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Two nucleotides (TT) were deleted from intron 8 (c.579+8_579+9delTT) using a crRNA (targeting CTCAGAAGATGTGGTTCCTG) and an ssODN template with CRISPR/Cas9 technology. This sequence could represent the last two nucleotides of phenylalanine codon 196 (TTT) in an unannotated alternatively spliced transcript, equivalent to codon F193 (TTT) in the human TMX3-204 (ENST00000562706.5) transcript. Another human alternatively spliced transcript TMX3-202 (ENST00000443099.6) has a TT deletion in codon F191 (in its alternative 3' end in what is intron 9 sequence for transcript TMX3-201) (SNP rs143627864), which leads to a frameshift and resulting stop codon (TAA) in place of the phenylalanine codon (F191fs*), in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Cep192em1Jlp allele. |
