| Primary Identifier | MGI:6406455 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnpep |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCTTGAGGCTGCTAAA and TCCCGGGTGAGGTTTCCCCT, which resulted in a 5393 bp deletion beginning at Chromosome 1 position 135,272,191 bp and ending after 135,277,583 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000241626 and ENSMUSE00000241618 (exons 3 and 4) and 5127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after amino acid 197. |
