Primary Identifier | MGI:6509468 | Allele Type | Endonuclease-mediated |
Attribute String | Not Specified | Gene | Cdc40 |
Strain of Origin | C57BL/6 | Is Recombinase | false |
Is Wild Type | false |
molecularNote | Using a crRNA (targeting TTCCTTATATCGTTGCAGTT), tracrRNA and an ssODN template (GGATTAGAGTTGAAAATACATTGTAATTTCAGGATCCTTCTTTTCCTTCCTTATATCGTTGCAGTTTGGAGCAGAAAATCCCTTTCGAACACAGCAAATGGCTGCCCCTAGAAATATGCTTTCTGGGTATGCAGAGCCAGC) with CRISPR/Cas9 technology, a C-to-G mutation (G-to-C on forward strand) was engineered to change proline codon 95 (CCA) to an alanine codon (GCA) (p.P95A). This mutation creates a non-isomerizable form of the encoded peptide. |