| Primary Identifier | MGI:6401345 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zdhhc22 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCTGAACCTGCCTGCCA and AGCATTGTCCAAGGTTCGAA, which resulted in a 607 bp deletion beginning at Chromosome 12 position 86,988,132 bp and ending after 86,988,738 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001414833 (exon 2) and 67 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele. |
