Primary Identifier | MGI:7543447 | Allele Type | Endonuclease-mediated |
Attribute String | Humanized sequence, Null/knockout | Gene | Mib1 |
Strain of Origin | C57BL/6 | Is Recombinase | false |
Is Wild Type | false |
molecularNote | Arginine codon 530 (AGA) in exon 11 was changed to a stop codon (TGA) (p.R530*) using an sgRNA (targeting TACGCTTATTACGAGCATTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human missense mutation (c.1588C>T) found in some left ventricular noncompaction (LVNC) patients. |