Primary Identifier | MGI:5689892 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Zfp174 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Zfp174-7014J-2R1L(MP1) was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATAGAGTGACCCCCTTACCC, TCCCAGCAGAGACATTCAGG, TGGGAGGCTGTGATGGAAAG, which resulted in a 194 bp deletion beginning in intron 2 at Chromosome 16 positive strand position 3,849,266 bp, TAAGGGGGTCACTCTATAGC, and ending after CTCCCAGCAGAGACATTC at 3,849,459 bp(GRCm38/mm10) in exon 2. This mutation deletes 85 bp of intronic sequence and the splice acceptor as well as 109 bp of exon 2 resulting in a complete deletion of exon 2. This mutation is predicted to result in a change of amino acid sequence after amino acid 134 and early truncation 4 amino acids later. There is also an additional 15 bp insertion, GAATGGAGATAAGAG, at position 3,849,603 bp in intron 3 that will not affect the predicted mutation. |