Primary Identifier | MGI:7465004 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Trappc8 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCGGCTCAAAATGTCTAGAT targeting the 5' side and CAGGTGTGAACTAGTACCAT targeting the 3' side of a critical region from exon 3 to exon 8 (ENSMUSE00000379803, ENSMUSE00000277191, ENSMUSE00000277177, ENSMUSE00000344646, ENSMUSE00000409531, and ENSMUSE00000277110). This resulted in a 10,577-bp deletion of Chr18 from 20997797 to 21008373 (GRCm39) introducing a frameshift and premature stop codon. |