| Primary Identifier | MGI:7539174 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pik3cd |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glutamic acid codon 1020 (GAA) in exon 22 was changed to lysine (AAA) (p.E1020K) using an sgRNA (targeting GAGCTTCGTTGAACTTCACCCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.E1021K gain-of-function (GOF) mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) disease. |
