Primary Identifier | MGI:5578178 | Allele Type | Targeted |
Attribute String | Conditional ready, Reporter | Gene | Gt(ROSA)26Sor |
Transmission | Germline | Strain of Origin | 129 |
Is Recombinase | false | Is Wild Type | false |
molecularNote | The targeting vector containins (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. |