| Primary Identifier | MGI:6257670 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Nhsl2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1180 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TAATGGTCCGCCTCCGCCTC targeting the 5' side and CTCAATGACCGTGGTGCCGG targeting the 3' side of a critical exon. This resulted in a 2323-bp ChrX:102076244 to 102078566; p.(R281Afs*39) resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). |
