| Primary Identifier | MGI:6156451 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr1b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0887 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GGCCGTCCCTTCCAACCAGA and GCCAACAAAGTGCAACCCTC targeting the 5' side and GGACTCGGCTACACTCAGTT and AACATCATAGAAGTGCTTAA targeting the 3' side leading to a 402-bp deletion from Chr2:129104981 to 129105382 (GRCm38). |
