| Primary Identifier | MGI:6357916 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hsfy2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACCATCACTCATCTTCTTG and GGATATGGCTGAAGCACCTT, which resulted in a 1177 bp deletion beginning at Chromosome 1 position 56,636,197 bp and ending after 56,637,373 bp (GRCm38/mm10). This mutation deletes 1177 bp from ENSMUSE00000411336 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and truncation 18 amino acids later by read through into the 3-prime UTR. |
