| Primary Identifier | MGI:5911955 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Riok1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAAAGCCAACACCCACTGA, ATTCATACACCTACTTTCAG and GGGATCCACAACATCTAAGC, which resulted in a 626 bp deletion beginning at Chromosome 13 positive strand position 38,039,914 bp and ending after 38,040,539 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117768 (exon 2) and 424 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small 6 bp (TGAAAG) deletion 121 bp before the 626 bp del that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 23 and early truncation 30 amino acids later. |
