| Primary Identifier | MGI:6195001 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tnrc6c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTATAAACCTTCATCAGTG, ACATGTGCAATTGTGTCCAA, AGCAAACTTCTAAGTATTTT and AGTAGTATCAAACTTTGCAA, which resulted in a 139 bp deletion beginning at Chromosome 11 position 117,702,396 bp and ending after 117,702,534 bp (GRCm38/mm10). This mutation deletes the last 5 bases of ENSMUSE00001287639 (exon 3) and 134 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 6 amino acids later, by read through into the intron. |
