| Primary Identifier | MGI:7564250 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Irx3 |
| Strain of Origin | 129P2/OlaHsd-Hprt1<b-m3> | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | An integration of a HA tag at the 3 ' end of the coding region of Olig2 Cas9 protein was injected directly into the blastocysts, together with guide RNAs (cgtcttaacttttcaaccat) and single-stranded DNA oligos of around 170 bp length, which carried the HA coding sequence flanked by sequences homologous to the region surrounding the natural stop codon of the corresponding gene. |
