|  Help  |  About  |  Contact Us

Allele : Mlh1<em6Jcs> mutL homolog 1; endonuclease-mediated mutation 6, John C Schimenti

Primary Identifier  MGI:7276207 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mlh1
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting CCACTTCCAGGGCTTTGACG) and an ssODN template (TGTGAAATGCTTCGGAGGTAGGAGGTGTGAGCGGAAGGCTTTATAGATAATGTGCTCCATAGTCCACTTCCAGGGCTTAGAGGTCGAGCCAGGCATGTCACTCTGGAAAATATATGACAC) with CRISPR/Cas9 technology, valine codon 720 (GTG) was changed to methionine (ATG) (c.2158G>A, p.V720M). This is the equivalent of the human p.V716M mutation.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mlh1<V716M>,
  • Mlh1<V716M>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele