| Primary Identifier | MGI:5638898 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ap4e1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ap4e1-6638-2877F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCAATCAAGTTGGCCCAACA, TGTCCTGACTGTCGTTTTTA and CTGTTTGTTTACATAGTGAT which resulted in a 1bp insertion A in exon 3 beginning at Chromosome 2 positive strand position 127,014,235 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 105 and early truncation 19 amino acids later. |
