| Primary Identifier | MGI:6156427 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Foxr1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0944 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) having spacer sequences of GGCCAAGCCCGGGTAGTATG and TCCACTGTTACCCCATGATC targeting the 5' side and CCGCAAGCCATCAGCCCAGA and TGAGTGCCAAGGCAATCAGA targeting the 3' side leading to the a 976-bp deletion from Chr9:44435486 to 44436461 (GRCm38). |
