|  Help  |  About  |  Contact Us

Allele : Mlh1<em1Jcs> mutL homolog 1; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:5804170 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mlh1
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting CGCTTACCAGATGGTCCGTA) and ssODN template (CACGACAGGGGTGGCTTCCTCATCCACTAGTGGAAGTGGCGACAAGGTCTACGCTTACCAGATGGATCGTACGGACTCCCGGGAGCAGAAGCTTGACGCCTTTCTGCAGCCTGTAAGCAGCCTTGGG) with CRISPR/Cas9 technology, valine codon 384 (GTC) was changed to aspartic acid (GAT) (c.1151_1152delTCinsAT, p.V384D). This mutation mimics human SNP rs63750447.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Mlh1<V384D>,
  • Mlh1<V384D>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele