| Primary Identifier | MGI:5754580 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Minar1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0387, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences GGGCACAGAGTGACTTGCAC, ACTGTATCCCCCAGTTTGGT and ACTTCGGGTCAGGCCAAGTA. This resulted in a 1,410 bp deletion from 89601843 to 89603253 on Chr 9 encompassing exon ENMUSE00000334339. This mutation is predicted to cause a frameshift with amino acid changes after residue 31 and early truncation 2 amino acids later (p.C31Tfs*4). (GRCm38). |
