Primary Identifier | MGI:5912110 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cdk17 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCTATGCTCGAGATCCAC, GAGGCACTGTTTACCTTTAA, GCTTGTTTGAAGCATCATGA and TTTTTTCCCTAATTATCCCA, which resulted in a 360 bp deletion beginning at Chromosome 10 positive strand position 93,216,203 bp and ending after 93,216,562 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000574151 (exon 4) and 226 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 3 amino acids later. |