Primary Identifier | MGI:6273284 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Pcsk2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NTac |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCTACCTTGAATTTAGTTCAACA, CACGTATTTTAGAGCAAATTTGG, CCTGAAACGTCTTCCAACCCCAT, CCCTTCATCCTGATCAGTTGGTG, which resulted in a Exon Deletion. |