|  Help  |  About  |  Contact Us

Allele : Abca16<em1(IMPC)J> ATP-binding cassette, sub-family A member 16; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5659623 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Abca16
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Abca16-6894J-M2454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GTTTCATCTCTAAAGTCACT, TAACTTGTCTGGCCACCAGA and CAAGCTACTACTGTTATGCC, which resulted in a 112 bp deletion beginning in intron 2 at Chromosome 7 positive strand position 120,431,039 bp, at ACTTGGTTTTCTACTGGGATGTA, and ending after TTGGTGCACAGAGGACCATCT at position 120,431,150 bp in exon 2 (GRCm38). This mutation deletes 43 bp in exon 2 as well as the splice acceptor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 20 and early truncation 43 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Abca16<em1J>,
  • Abca16<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories