Primary Identifier | MGI:6158462 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Angpt2 |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 2 guide sequences CCAACTGCCTTGTCTTGACGTGG, TTCTGACCCATATATGCTCCAGG, which resulted in a Exon Deletion. |