| Primary Identifier | MGI:7450833 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttc12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAAGGGTAGACAGTATCGT and GCTGGGCCAAACTAGAAAAC, which resulted in a 321 bp deletion beginning at Chromosome 9 position 49,470,103 bp and ending after 49,470,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296287 (exon 6) and 199 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 15 amino acids later. There is a 5 bp insertion (TCACT) at the deletion site. |
