| Primary Identifier | MGI:6358784 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc16a11 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology targeted the first exon (guide RNA sequences: GCCGCAGCATTCGCCGTGAA+CGG) and generated a 38 bp deletion (CGTAGGAGAGCCCGTTCACGGCGAATGCTGCGGCCGCC) resulting in a frame shift that is expected to produce a truncated protein with 33 amino acids. Expression of the mRNA is only about 10% of that of wild-type and Western blot analysis confirmed absence of protein in livers due to nonsense-mediated decay of mRNA. |
