Primary Identifier | MGI:6257766 | Allele Type | Endonuclease-mediated |
Gene | Otof | Inheritance Mode | Not Specified |
Strain of Origin | C57BL/6N | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and the guide sequence CCTCTATTTCTGAAGGCCCCGTG, which resulted in a Point Mutation allele. |