Primary Identifier | MGI:6514369 | Allele Type | Targeted |
Attribute String | Conditional ready, Inducible, Reporter, Transactivator | Gene | Igs7 |
Transmission | Germline | Strain of Origin | (129S6/SvEvTac x C57BL/6NCrl)F1 |
Induced With | doxycycline/tetracycline | Is Recombinase | false |
Is Wild Type | false |
molecularNote | The vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Hdac1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP. The TRE2 promoter used here is Tet-responsive P>hCMV*-1<; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P>min CMV<), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P>hCMV*-1< is silent in the absence of tTA or rtTA binding to tetO. The EGFP/RNAi:HDAC1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~150bp linker sequence and a 97bp short hairpin RNA sequence (tgctgttgacagtgagcgagcttgggtaatagcagccatttagtgaagccacagatgtaaatggctgctattacccaagcctgcctactgcctcgga) designed to target/silence the mouse histone deacetylase 1 locus (Hdac1). |