| Primary Identifier | MGI:5795757 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cachd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cachd1-7843J-M9819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACATATAAACGACACCC, AAACACCTGGACATCATGGT, GCAAGTAATGAGAGATTCAC and ATCTCTATATTTAAACTTGT, which resulted in a 498 bp deletion beginning at Chromosome 4 positive strand position 100,897,481 bp CTACCATGATGTCCAGGTGT, and ending after CTTGTCGGCTTCTGCCCGTG at 100,897,978 bp (GRCm38/mm10). This mutation deletes exon 3 and 349 bp of flanking intronic sequence including the splice acceptor and donor, there is a single bp insertion T at this site, which will not effect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 101 and early truncation 1 amino acid later. |
