| Primary Identifier | MGI:6275630 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 4933402J07Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTCCTATTTAGAGACAGT and GGTTGTTAGGGAATCACCCA, which resulted in a 950 bp deletion beginning at Chromosome 8 position 87,567,814 bp and ending after 87,568,763 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000581161 and ENSMUSE00000581160 (exons 2 and 3) and 721 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 13 amino acids later. |
