| Primary Identifier | MGI:7562143 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tpbgl |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GAGACCCGAGCCTGGAGAAG and CCCCGCGCGCGGGACAGCGG, which resulted in a 1131 bp deletion beginning at Chromosome 7 position 99,625,502 bp and ending after 99,626,632 bp (GRCm38/mm10). This mutation deletes 1131 bp from ENSMUSE00001008045 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4, delete 378 amino acids, then return into frame for the last 2 amino acids before the stop codon. |
