Primary Identifier | MGI:6257484 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Phf11c |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project TCPR1078 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTCTAATTCCTATTTAGTG and GCAGGCCAGTGTTTTTGTCC targeting the 5' side and GCTCATTCCCACATAGTATG targeting the 3' side of a critical exon. This resulted in a 578-bp deletion Chr14:59388910 to 59389487;1-bp deletion at Chr14:59389528 (GRCm38). |